Clik here to view.
Using HTML inside shell script
Hi, Am trying to use HTML tags inside my script but its not printing the required output. Any idea how to use html inside script will be helpful. Code: #!/bin/ksh echo '<html>' echo '<font...
View ArticleChanging root password
I want to change the root password on an AIX box. What is the best method to do this so i do not get myself locked out. When I do i search the results come up for resetting the password if you are...
View Articleawk line instance counter
I Have a text file with several thousand lines of text. Occasionally there will be a "sysAlive" line of text (every so often) What would be an awk command to print every line of text, and to put in...
View ArticleMoniter files and merge
Hi All, I have a requirement where I need to monitor the files in a directory for 15 secs and if the size of the files are not changing within that time I would like to merge all the data in those...
View ArticleAdd line number to for loop?
Code: > cat test.sh for t in `cat out.txt` do echo create directory data as "'"$t"';" done > output of out.txt is as below Code: /oracle/SID/data1/file2_1/ /oracle/SID/data1/file1_1/...
View ArticleHelp Needed with Shell Script
I need help writing a Unix shell script that does the following: 1) Searches all of the files in a given directory that have the .acl file extension 2) Redirects the output of the search to a column in...
View ArticleSolaris 10 patching using live upgrade with VxVM
Hello, I was assigned some Solaris machines and need to patch them to N-1, where N is the latest OS realease, which means, upgrade till one version before the latest one. I do not now a lot about...
View ArticleIn ksh script what is this BEGIN and END in this function?
Can Someone please explain why BEGIN and END statement is used inside function? How does that help in scripting? Code: function fileformatting { Ā CleanupMask="xXxX" Ā sed 's/^.//' < ${AllFile} >...
View ArticleNeed help with looping through file contents
Hi, I have a several files with ".out" extension in a folder and each file has the below like contents Code: .... appname: wonder1 ..... logname78.log logname88.log ..... CAP: 2 ..... appname: wonder54...
View ArticleHow I can find the last file created and move it to a directory?
I have this situation /u03/app/banjobs> ls -ltr icg* 82 Jun 12 10:37 iicgorldi_2419186.log 56810484 Jun 17 10:35 icgorldi_2421592.xml 2859 Jun 17 10:35 icgorldi_2421592.lis - 125 Jun 17 10:35...
View ArticleDNS config preventing mail delivery
Hi Please can you help on this: the Net Admins decided to use DNS to resolve names, so this is preventing mail being delivered when using commands like Code: date | mailx -s "test" abc.xyz@asdf.xx.yy ....
View ArticleHow to pass variable to a query?
Hi All, How to pass date variable to a query? I have tried the below one , but it's not working. ost.ksh Code: #!/bin/ksh v_date=$1 var=$(sqlplus -s $ORACON <<ENDOFSQL SELECT...
View ArticleHow to set the screensaver timeout on Red Hat?
How is it possible to set the screensaver timeout on red hat. For solaris I understand it is : Code: for file in /usr/dt/config/*/sys.resources; do dir=`dirname $file | sed s/usr/etc/` mkdir -p $dir...
View ArticleFTP Server Unable to Login
FTP Server in P590 machine was unable to login, Torwing error while login. Tried to change password through maintenance mode by running AIX 5.3 OS CD, But CD row was unable to detect for the particular...
View ArticleHelp with comparing contents of a file
I have a script that outputs a file in the below format Code: group1:user1,user2,user3, user4 group2:user2, user4, user5 group3: user1, user6, user7 If there is a change in /etc/passwd with...
View ArticleTrimming ends
My files look like this Quote: >GHXCZCC01AJ8CJ ACGTGCGTGGGAAATTGATGTGCTTGGTGTGTATCATTTCTGGGAAGCCCTACGCCCCGGGGC >GHXCZCC01APUO5...
View ArticleGrep command giving different result for different users for same command
Hello, I am running below command as root user Code: #nodetool cfstats tests | grepĀ "Memtable switch count" Memtable switch count: 12 Where as when I try to run same command as another user it gives...
View ArticleClik here to view.
Oracle Solaris Cluster 4.X on ESXI 6.X
Trying to install Solaris 11.2 SRU June 2014 / Cluster 4.2 on ESXI 6.0, configure shared disks between node1/node2 adjusted SCSI controller (SCSI1), in "physical mode", disks create with "eager zeroed...
View ArticleFormatting of output
Hi, I have some output in the format below: Col-A Col-B 8781 4319 8781 2332 8781 0269 5550 3282 5550 9465 5550 7607 7064 4456 . . I want to re-format the output so i will get something like this:...
View ArticleHow to print N number of lines before and after the grep?
Hi , My record file , need to print up to above (DATA array)(there may be n no lines ) , grep "myvalue" row now .....suggest me some options --- DATA Array--- record type xxxxx sequence type yyyyy 2...
View Article